Genomic and transcriptomic analysis of Ligilactobacillus salivarius IBB3154—in search of new promoters for vaccine construction

Bacterial strains, plasmids, and primers used in this study are listed in Supplementary Material (Tables S1 and S2). The Ligilactobacillus salivarius IBB3154 strain was routinely cultured in de Man, Rogosa, and Sharpe (MRS) broth or MRS agar (solidified with 1.5% agar) medium (Oxoid) at 37°C without shaking under microaerobic conditions provided by Anoxomat Mark II OP (MART Microbiology B.V.). The Escherichia coli strains, used as hosts for the construction of recombinant plasmids, were grown under standard conditions unless otherwise indicated. The E. coli strain MC1061 (recA ⁺) was used for cloning purposes in pNZ8008. When needed, the medium was supplemented with antibiotics at the following final concentrations: for E. coli, 20 µg/mL chloramphenicol, 100 µg/mL ampicillin, and for L. salivarius, 10 µg/mL chloramphenicol.

Whole genome sequencing of the L. salivarius IBB3154 strain was carried out in the DNA Sequencing and Synthesis Facility in the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences. Total genomic DNA was isolated using the cetyltrimethylammonium bromide/lysozyme method (25) with minor modifications. The bacterial cell wall was digested enzymatically before lysis with sodium dodecyl sulfate using lysozyme (20 mg/mL; Sigma-Aldrich, Dorset, UK) and mutanolysin (5 U/mL; A&A Biotechnology, Gdańsk, Poland) for 15 min at 37°C. After isolation, DNA integrity was checked by electrophoresis on a standard 1% agarose gel and by pulsed-field gel electrophoresis on a CHEF-DR III apparatus (Biorad Laboratories, Hercules, CA). Genomic DNA concentration was measured by fluorimetry using a Qubit 2.0 (Thermo Fisher Scientific, Waltham, USA). The DNA sample was sheared into approximately 20 kb fragments using a Covaris gTUBE (Covaris Ltd., Brighton, UK), and the sequencing library was constructed using a SMRTbell template prep kit version 1.0. The library sample was loaded into a single single-molecule real-time cell and sequenced on the RS II instrument (Pacific Biosciences, Menlo Park, CA). Additionally, the bacterial genome was sequenced using Illumina technology. Genomic DNA was mechanically sheared to an appropriate size by nebulization and used for Paired-End TruSeq-like library construction using the KAPA Library preparation kit (KAPA/Roche, Basel, Switzerland) following the manufacturer’s instructions. The bacterial genome was sequenced in paired-end mode (v3, 600 cycle chemistry kit) using the MiSeq instrument (Illumina, San Diego, CA). Illumina sequence reads were filtered for quality using the FastX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). PacBio reads were assembled into contigs using Canu v1.6 (26). The Canu assembly was further polished using Illumina reads and Pilon v1.22 (27). The remaining sequence gaps and ambiguities in genome assembly were closed and verified by the PCR amplification of DNA fragments, followed by Sanger sequencing with an ABI3730xl Genetic Analyzer (Life Technologies, Thermo Fisher Scientific, Waltham, USA), using BigDye Terminator Mix v. 3.1 Chemistry (Thermo Fisher Scientific, Waltham, USA). The genome was manually closed using Seqman software (DNAStar, USA) to obtain a complete nucleotide sequence of the bacterial genome.

RNA extraction and RNA-seq were performed in the DNA Sequencing and Synthesis Facility in the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences. Bacterial cells were inoculated in triplicate in 100 mL of MRS broth. Each triplicate was incubated at 37°C and 42°C for 5 h (OD₆₀₀ ~ 1). Cells were harvested as rapidly as possible by centrifugation at 5,000 rpm for 10 min. The growth medium was removed, and the cells were resuspended in StayRNA reagent (A&A Biotechnology, Gdańsk, Poland), aliquoted into 2 mL portions, and incubated overnight in the freezer. After overnight incubation, the StayRNA reagent was removed by centrifugation, and the bacterial cell pellets were stored at −70°C. After thawing, the bacterial cells were resuspended in 50 µL of Tris-EDTA buffer containing 10 mg/mL of lysozyme (Sigma, USA) and 1 U/mL of mutanolysin (A&A Biotechnology, Gdańsk, Poland) and incubated for 15 min at 37°C. The cells were then centrifuged, and the enzyme cocktail was removed prior to lysis with Fenozol reagent (A&A Biotechnology, Gdańsk, Poland). Total RNA was extracted using the Total RNA Mini Plus kit (A&A Biotechnology, Gdańsk, Poland). The RNA was treated with Rnase-free Dnase (A&A Biotechnology, Gdańsk, Poland) to remove any contaminating genomic DNA, according to the manufacturer’s protocols. RNA quality was assessed using the Agilent 2100 Bioanalyzer system and the RNA 6000 Nano Chip (Agilent Technologies, Santa Clara, USA). The quantity of RNA was measured by fluorimtery using a Qubit2.0 fluorimeter (Thermo Fisher Scientific, Waltham, USA). Ribosomal RNA species were depleted using the RiboZero rRNA (Bacteria) Removal Kit (Illumina, San Diego, USA). The quality of the RNA and the absence of the 16S and 23S rRNA species were quality checked on an Agilent Bioanalyzer 2100 using the RNA 6000 Pico kit.

Six independent RNA-seq libraries were constructed with the KAPA Stranded RNA-Seq kit (KAPA-Roche, Basel, Switzerland) following the manufacturer’s protocol. The quality and quantity of purified libraries were checked using the Agilent 2100 Bionalyzer, Qubit2.0 (Life Technologies, Thermo Fisher Scientific, Waltham, USA), and the KAPA Library qPCR Quantification Kit (KAPA-Roche, Basel, Switzerland) and subsequently sequenced on an Illumina NextSeq 500 instrument with 75 nucleotide single-end reads. The raw reads were trimmed for quality using the FastX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) and the remaining Illumina adapters were removed using cutadapt (https://github.com/marcelm/cutadapt). Cleaned sequencing reads were mapped to the L. salivarius 3,154 genome with CLC Genomics Workbench 9.0.1 (https://www.qiagenbioinformatics.com/), and the rest of the analysis was done with this software package. The statistics of the RNA-seq data set have been presented in the Supplementary Material (Table S3). The abundance of gene expression was normalized by fragments per kilobase of exon per million mapped fragments. Differentially expressed genes (DEGs) were identified, with the threshold set to 1.8-fold change and a P-value <0.05 as the criteria for a significant difference in gene expression.

Standard DNA manipulations were performed as described in the Sambrook manual (28) or according to the manufacturer’s instructions (A&A Biotechnology, Poland). The chromosomal DNA of L. salivarius IBB3154 used for PCR reactions was isolated using a commercial kit and protocol (A&A Biotechnology, Poland). Cells were pretreated with mutanolysin for 1 h. PCRs were performed with HotStar HiFidelity Polymerase (Qiagen) or PrimeStar HS DNA Polymerase (Takara) under standard conditions. Synthetic oligonucleotide synthesis and DNA sequencing for cloning experiments were performed by Genomed S.A. (Warsaw, Poland). The DNA fragments containing Ligilactobacillus promoters were synthesized by GeneCust (France).

The DNA fragments containing the promoter of the sas1 gene (P _sas1 ) and the promoter of the sas2 gene (P _sas2 ) were synthesized by GeneCust and cloned into pBluescript II SK + digested with PstI and XhoI, generating the plasmids pUWM1476 and pUWM1477, respectively. Then pUWM1477 was digested with BglII and EcoRI, and a 0.5-kb DNA fragment was inserted into pNZ8008/BglII and EcoRI, resulting in pUWM1481. To introduce new sites recognized by restriction enzymes, the DNA fragment containing (P _sas1 ) was amplified from pUWM1476 with the pair of primers pUWM1476_BglII and pUWM1476_PstI and cloned into pJET 1.2 (Thermofisher, USA). Subsequently, the resulting plasmid, pUWM1486, was digested with BglII and PstI, and a 0.5-kb DNA fragment was inserted into pNZ8008/BglII and PstI, generating the plasmid pUWM1491.

The 0.28-kb DNA fragment that contains the promoter of the usp45 gene was amplified from the L. lactis subsp. Lactis IL1403 chromosome (GenBank accession number AE005176) [PrimeStar HS DNA Polymerase (TaKaRa)] using the primer pairs Usp45_BglII and Usp45_PstI. The PCR product was purified and cloned into pJet1.2/blunt to generate pUWM1553. Subsequently, the BglII-PstI DNA fragments of pUWM1553 and pNZ8008 digested with the same enzymes were ligated. The resulting plasmid, designated pUWM1565, contains fragment DNA that includes the promoter of the usp45 gene.

The plasmid containing fragment DNA with the promoter of the fructose-bisphosphate aldolase (P _fbaA ) gene was created in a similar way. Briefly, the 0.5-kb DNA fragment containing the promoter of the fbaA gene was amplified from the chromosome of L. salivarius IBB3154 [HS DNA Polymerase (TaKaRa)] using the primer pairs Faldo_BglII and Faldo_PstI. The PCR product was purified and cloned into pJet1.2/blunt to generate pUWM1488. Subsequently, the BglII-PstI DNA fragments of pUWM1488 and pNZ8008 digested with the same enzymes were ligated. The resulting plasmid was designated pUWM1498.

E. coli was transformed as previously described (29). Recombinant plasmids pUWM1481, pUWM1491, pUWM1498, and pUWM1565 were introduced into L. salivarius cells by electroporation (30). To prepare the competent Ligilactobacillus strain cells, an overnight culture was inoculated 1:50 in MRS containing 1% glycine and incubated at 37°C under microaerobic conditions until an OD₆₀₀ of 0.5 was reached. Bacteria were collected (4,000 rpm, 10 min, 4°C), and the pellet was washed three times in electroporation buffer (1 M sucrose, 3.5 mM MgCl₂). The bacteria were resuspended 1:100 in the same solution, and a volume of 20 µL was immediately electroporated or kept at −70°C for further use. L. salivarius competent cells were electroporated at 2.5 kV, 400 Ω, and 25 µF in 0.2 cm cuvettes using a BioRad GenePulser (BioRad, Life Science Research Products, CA, USA). After electroporation, Ligilactobacillus cells were resuspended in MRS broth containing 0.5 M sucrose and 100 mM MgCl₂ and incubated at 37°C for 3 h. After incubation, bacteria were plated on MRS supplemented with chloramphenicol (10 µg/mL). The plates were incubated at 37°C for 2 days.

For the β-glucuronidase (GUS) activity assay, L. salivarius IBB3154 cells carrying plasmids encoding β-glucuronidase under the control of tested promoters were used. Ligilactobacillus strains were grown in MRS broth supplemented with chloramphenicol and bile salts (0%, 0.05%, 0.1%, and 0.2%) under microaerobic conditions at 37°C or 42°C (25 mL). After reaching log phase growth (A₆₀₀ = 0.6), cells were harvested by centrifugation (4°C, 5 min, 8,600 × g) and washed twice in ice-cold GUS buffer (4 mL; 100 mM Na₃PO₄ and 2.5 mM EDTA, pH 6.0). Subsequently, the cell pellet was thoroughly suspended in 1 mL of GUS buffer and disrupted by beating the beads for three 1 min cycles, with intervals of at least 1 min, during which the cells were kept on ice (FastPrep Instrument; MP Biomedicals, Santa Ana, CA). After centrifugation (8,600 × g, 2 min, 4°C), cell-free extracts were stored on ice and used immediately. Protein concentrations were determined using the bicinchoninic acid protein assay kit (BCA kit; Sigma-Aldrich).

For the determination of β-glucuronidase activity, 100 µL of each cell extract (0.1 mg/mL) were transferred to a black 96-well plate and incubated for 1 min at 37°C. Then, 100 µL of 2 mM MUG (4-methylumbelliferyl-beta-D-glucuronide), a fluorogenic substrate of β-glucuronidase (Sigma-Aldrich), was added, and the mixture was incubated for 10 min at 37°C. After incubation at 37°C for 10 min, 50 µL of 3.2 M Na₂CO₃ was added to stop the reaction. Subsequently, fluorescence intensity was measured using a 96-well plate reader at 355 nm excitation and 460 nm emission (Synergy HTX, BioTek). For each experiment, standards were prepared for the GUS assay. To obtain a standard curve (0–250 nM 4-MU), 1 mM 4-MU (4-methylumbelliferyl) stock was diluted to 5, 10, 20, 50, 100, and 200 nM in GUS/Stop buffer (buffer GUS:3.2 M Na₂CO₃, 4:1, vol:vol).

Units of GUS activity were described as nanomoles of 4-methylumbelliferone released per minute per milligram of protein. Three biological replicates were performed for all experiments.

Open reading frames (orfs) and noncoding RNAs were annotated using the RAST server [http://rast.nmpdr.org/ (31)] and, when needed, checked by BLAST analysis. BASYs [https://www.basys.ca/ (32)] software was used to construct Clusters of Orthologous Groups (COGs) of predicted proteins. Possible bacteriophages were identified using PHAST [http://phast.wishartlab.com/ (33)]. The Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) loci were searched using the CRISPRFinder tool [http://crispr.i2bc.paris-saclay.fr/ (34)]. Genome visualization was performed using the CGView server [http://cgview.ca/ (35)]. Antibiotic resistance genes were searched using the Comprehensive Antibiotic Resistance Database (CARD) Resistance Gene Identifier (RGI) (36).

Differences in β-glucuronidase activities in tested strains were analyzed with GraphPad Prism 7.0 software (GraphPad Software, CA, USA) using one-way analysis of variance with Bonferroni correction. P-values below 0.05 were considered significant.

To facilitate transcriptomic analysis, we determined the complete genome sequence of L. salivarius IBB3154. In addition to the circular chromosome of 1,921,419 bp, two circular plasmids were identified. pIBB3154_1 is a 230,637-bp megaplasmid, while pIBB3154_2 is significantly smaller (13,457 bp). The guanine-cytosine (GC) content of the chromosome is on average 33% and, respectively, 32.3% and 32.2% for pIBB3154_1 and pIBB3154_2 (Fig. 1; Table 1). These values are in agreement with the GC content in L. salivarius subsp., which, among other lactobacilli, evolves under the strongest A + T bias (https://www.ncbi.nlm.nih.gov/genome/microbes/).

A total of 1,894 genes were found on the chromosome, of which 1,794 were annotated as protein-coding genes. At the origin of replication, there is a clear-cut GC skew and skewed distribution of genes on the two DNA strands, so that their transcription is in the same direction as the replicative fork migration (Fig. 1). Seventy-five functional tRNA genes representing all amino acids and seven complete rRNA operons were identified, four on the forward strand and three on the reverse strand. Six rRNA operons are gathered in the vicinity of some of the tRNA genes (Fig. 1). All rRNA operons and most tRNA genes are organized in the direction of fork migration.

A total of 1,280 genes from the entire chromosome (~70%) had a putative biological function, while the other ~30% genes were assigned as hypothetical or of unknown function. Out of the total of 1,894 predicted proteins, 1,248 (65.9%) could be assigned to COGs functional category. About 11% of these proteins are involved in cellular processes and signaling (categories D, M, N, O, and T), 20% in information storage and processing (categories J, K, and L), 25% in metabolism (categories C, E, F, G, H, I, P, and Q), and 12% are poorly characterized (categories R and S) (Table S4).

As many as 51% of proteins encoded by 116 genes in pIBB3154_1 could not be assigned to any COG functional category; 9% are involved in cellular processes and signaling (categories D, M, O, T, and V), 14% in information storage and processing (J, K, and L), 18% in metabolism (C, E, F, G, I, and P), and 7% are poorly characterized (R and S). Similarly, 60% of the proteins encoded by 15 genes in pIBB3154_2 are also not included in any of the COG categories, while others are involved in cell wall/membrane/envelope biogenesis (COG category M), transcription (K), and replication, recombination, and repair (L) (Table S3). In both plasmids, genes belonging to the L category are the most strongly represented, including those coding for integrases, recombinases, and transposases/insertion elements. The occurrence of such mobile sequences in plasmids is a rather common feature, also in plasmids from Lactobacillus spp. (37). and indicate that many of the plasmid-located operons could undergo recombination events within this genus or even beyond.

A widespread presence of prophages in Lactobacillus spp. has been reported (38) and IBB3154 was usual in this respect. One incomplete (27.2 kb) and two intact prophage regions ranging in length from 18.6 to 26.6 kb were identified (Fig. 1). One of them contains a phage attachment site and another harbors an IBB3154_0897 gene that encodes a putative phage lysin, indicating that this phage may undergo the lysogenic pathway.

CRISPR are a sort of bacterial immune system that confers resistance against mobile genetic elements. CRISPRs are often located adjacent to cas genes encoding Cas (CRISPR-associated) proteins (39). The Type IIA CRISPR-cas system (CRISPR_2) and two possible CRISPRs are present in the IBB3154 genome (Fig. 1). The CRISPR_2 locus contains six conserved direct repeats of a 36-bp-long sequence with the consensus of 5′ GTTTCAGAAGTATGTTAAATCAATAAGGTTAAGACC 3′ preceded by four cas genes (IBB3154_0123, IBB3154_0124, IBB3154_0125, and IBB3154_0126) encoding, respectively, the Cas9, Cas1, Cas2, and Csn2 proteins.

The CARD database detected only one gene (vanT), whose product is involved in antibiotic resistance. No genes associated with virulence or pathogenicity factors were identified in the genome of L. salivarius IBB3154 [according to VFDB (40)].

For comparative transcriptomic analysis, the RNA-seq methodology was used. Total RNA was isolated from bacterial cells growing at 42°C and 37°C. The transcriptome library was constructed, and the resulting amplified cDNA library was sequenced. The RNA-seq reads were aligned to the complete genome sequence of the L. salivarius IBB3154 strain, and to identify DEGs, we analyzed the count data from RNA-seq sequencing assays and identified differentially expressed genes (Table 2). Comparative transcriptomic RNA-seq resulted in the identification of genes whose expression was different in bacterial cells growing at 42°C and 37°C. The expression level of the 11 genes was approximately twice as high at 42°C compared to their expression at 37°C. Five genes showed twice as much expression at 37°C. The classification of genes showing different expressions in the studied temperatures by Kyoto Encyclopedia of Genes and Genomes pathway analysis revealed that they are involved in numerous biological pathways, including metabolism—degradation of glycerol (dihydroxyacetone binding subunit, dhaK), purine metabolism (adenine deaminase), phosphonate and phosphinate metabolism (choline-phosphate cytidylyltransferase), and osmoregulation (opuD). We paid attention to two genes that both had a high level of expression and showed differences in the level of expression depending on the culture temperature used (Table 2). These genes encode the predicted cell wall-anchored proteins SasA1 and SasA2. A comparison of the amino acid sequences of the SasA1 and SasA2 proteins with the sequences available in the databases indicates that they belong to the group of serine-rich repeat proteins (SRRP). These proteins in gram-positive bacteria mediate adherence to various surfaces of the host. Many of them are virulence factors that contribute to bacterial pathogenesis and biofilm formation (41 – 43). SRRP proteins are characterized by highly glycosylated serine-rich regions and one or two species-unique regions (NR domains) located at the N-terminus. At the C-terminus, they contain a hydrophobic region, a positively charged tail, and a sortase family LPXTG motif recognized by surface peptidases, which catalyze the cleavage of the threonine-glycine bond and then covalently bind the protein to the peptidoglycan layer (43). The export of SRRP proteins to the surface of bacterial cells takes place using SecY2A2, after recognition of the signal peptide sequence located at the N-terminus. This secretion system (aSec) consists of the SecA2 protein, the SecY2 translocon channel, and three to five additional Sec proteins (Asp1–5). Genes encoding these proteins are usually found in the same gene cluster as the srrp gene (44). Searching the genomic sequence of strain L. salivarius IBB3154 showed that in the vicinity of the sasA1 gene there are genes that build the secretion system as well as genes involved in the O-glycosylation process.

In addition, we identified genes that are highly expressed in cultures grown at both temperatures. Proteins encoded by those genes (Table 3), mainly involved in basic metabolic pathways or essential for the maintenance of basic cellular functions, are highly conserved. What is interesting is that some of them are also known as moonlighting proteins, which means that besides their canonical functions, they were also adopted for other activities. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a ubiquitous enzyme involved in glycolysis. As a surface-associated protein, GAPDH in many pathogenic bacteria can bind to host proteins such as fibronectin, plasminogen, or laminin. The disruption of the extracellular matrix facilitates bacterial dissemination within the host organism (45). Conversely, when located extracellularly, GAPDH exerts immunomodulatory effects, influencing both innate and acquired immunity (46, 47). Similarly, FBA (fructose-bisphosphate aldolase), an enzyme of the glycolytic pathway, promotes adhesion to host cells (48). Despite its highly conserved function in protein synthesis, non-canonical functions have also been described for elongation factor Tu (Ef-Tu). The cell surface-associated Ef-Tu mediates the attachment of Lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins (49). Enolase, generally known as the cytoplasmic enzyme involved in glycolysis and gluconeogenesis, was found in Lactobacillus gasseri ATCC 33323 associated with the cell surface, which inhibits the adhesion of the sexually transmitted pathogen, Neisseria gonorrhoeae, to epithelial cells (50).

As the level of gene expression depends, among other things, on the efficiency of promoter, we decided to analyze the upstream region of genes encoding the above-mentioned proteins. To analyze the strength of the promoters, we used the gus reporter gene, which encodes β-glucuronidase. For the β-glucuronidase activity test, we chose promoters of genes encoding predicted cell wall-anchored protein SasA1 (P _sas1 ) and predicted cell wall-anchored protein SasA2 (P _sas2 ), which were shown in the comparative transcriptomic assay as temperature inducible. Based on the analysis of the nucleotide sequence preceding the sasA1 and sasA2 genes, the potential promoter sequences were determined: −10 and −35, which is largely consistent with the consensus established for Lactobacillus sp. genes read by RNA polymerase with the main sigma factor (σ70) (Fig. 2). Additionally, we analyzed the promoter of the gene encoding fructose-bisphosphate aldolase (P _fab ), as the transcriptome analyses showed a high level of its expression. Attempts to clone the estimated promoter of high-expression genes: hypothetical protein FIG00747762 (P _hp762 ), NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (P _NAD ), and enolase (P _eno ), into pNZ8008 have failed. We assume that the promoters were too strong, and therefore the high expression of the reporter gene was toxic for Ligilactobacillus sp. cells.

As the base for constructing a series of expression vectors, we used the derivative of the pSH71 plasmid, pNZ8008, in which the β-glucuronidase gene was cloned under the control of the nisin-induced promoter, P _nis . It was confirmed that the pSH71 replicon can replicate in L. salivarius IBB3154 cells. In constructed plasmids, we replaced P _nis with the analyzed promoters P _sas1 (pUWM1491), P _sas2 (pUWM1481), and P _fab (pUWM1498). β-glucuronidase activity was tested in L. salivarius IBB3154 cells harboring the expression vectors grown at 42°C and 37°C. As a negative control, we used L. salivarius carrying pNZ8008 cultured in a medium without the addition of nisin. As a positive control, we used cells of the L. salivarius IBB3154 strain harboring the vector-coding β-glucuronidase under the control of a commonly used promoter of the usp45 gene (pUWM1565), described as a strong promoter derived from strains of Lactoccocus lactis (Fig. 3) (23, 51).

In addition, there was no difference in the β-glucuronidase expression between the two promoters even though the transcriptomics indicated that the sasA2 promoter was approximately four times stronger than the sasA1 promoter. However, the data presented indicate that both promoters—P _sasA1 and P _sasA2 —are strong promoters with high activity at both temperatures. The promoter of the gene encoding fructose-bisphosphate aldolase (P _fab ) was characterized by much lower activity.

In the digestive tract, lactic acid bacteria encounter various stressful conditions. Intraluminal pH conditions change from slightly acidic in the crop (4.5–6.5), through highly acidic in the proventriculus and gizzard (1.9–4.5), to a level above six in the intestine (52). Additionally, the gastrointestinal tract (GI) has an osmolarity equivalent to 0.3 mol/L of NaCl (53). Moreover, LABs are exposed to bile acids, compounds essential for digestion and nutrient absorption. Determining whether selected promoters retain their activity in the intestinal environment is crucial for creating a vaccine-antigen-producing strain.

The activity of the reporter gene was assessed in the presence of bile salts. Addition of bile salts reduces the strength of the tested promoters. However, in the Ligilactobacillus sp. strains that carry the plasmids pUWM1498 (P _fab ) and pUWM1565 (P _usp45 ), the expression of the reporter gene is inhibited at a concentration of 0.1%. In the case of the Ligilactobacillus strain that carries the plasmid containing the promoter sequence of the sas1 gene, β-glucuronidase activity reaches the level of P _fab activity observed in medium without the addition of bile salts, and the activity level is low (Fig. 4).